Review



data myc targeted long noncoding rna dancr promotes cancer  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Qiagen data myc targeted long noncoding rna dancr promotes cancer
    Upregulation of lipid metabolic genes by <t>MYC.</t> (A) Diagram of MYC’s regulation of the fatty acid synthesis pathway. (B) qPCR shows fatty acid synthesis mRNA expression in high MYC (MYC ON, N=3 per cell line) compared to 24 hours of MYC inactivation (MYC OFF, N=3 per cell line) in BCL (P493–6) and RCC (E28). Expression of lipogenesis proteins for BCL (P493–6) and RCC (E28) cells with MYC ON vs. MYC OFF, by Western blot analysis. Statistical significance by t-test, ***P<0.001. (C) <t>RNA-seq</t> analysis of lipid metabolic pathways in fold-change of RPKM comparing MYC ON/MYC OFF in BCL (P493–6).
    Data Myc Targeted Long Noncoding Rna Dancr Promotes Cancer, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 31036 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/data+myc+targeted+long+noncoding+rna+dancr+promotes+cancer/RNeasy+Plus+Mini+Kit/pmc06911354-763-136-133
    Average 99 stars, based on 31036 article reviews
    data myc targeted long noncoding rna dancr promotes cancer - by Bioz Stars, 2026-10
    99/100 stars

    Images

    1) Product Images from "The MYC Oncogene Cooperates with Sterol Regulated Element-Binding Protein To Regulate Lipogenesis Essential for Neoplastic Growth"

    Article Title: The MYC Oncogene Cooperates with Sterol Regulated Element-Binding Protein To Regulate Lipogenesis Essential for Neoplastic Growth

    Journal: Cell metabolism

    doi: 10.1016/j.cmet.2019.07.012

    Upregulation of lipid metabolic genes by MYC. (A) Diagram of MYC’s regulation of the fatty acid synthesis pathway. (B) qPCR shows fatty acid synthesis mRNA expression in high MYC (MYC ON, N=3 per cell line) compared to 24 hours of MYC inactivation (MYC OFF, N=3 per cell line) in BCL (P493–6) and RCC (E28). Expression of lipogenesis proteins for BCL (P493–6) and RCC (E28) cells with MYC ON vs. MYC OFF, by Western blot analysis. Statistical significance by t-test, ***P<0.001. (C) RNA-seq analysis of lipid metabolic pathways in fold-change of RPKM comparing MYC ON/MYC OFF in BCL (P493–6).
    Figure Legend Snippet: Upregulation of lipid metabolic genes by MYC. (A) Diagram of MYC’s regulation of the fatty acid synthesis pathway. (B) qPCR shows fatty acid synthesis mRNA expression in high MYC (MYC ON, N=3 per cell line) compared to 24 hours of MYC inactivation (MYC OFF, N=3 per cell line) in BCL (P493–6) and RCC (E28). Expression of lipogenesis proteins for BCL (P493–6) and RCC (E28) cells with MYC ON vs. MYC OFF, by Western blot analysis. Statistical significance by t-test, ***P<0.001. (C) RNA-seq analysis of lipid metabolic pathways in fold-change of RPKM comparing MYC ON/MYC OFF in BCL (P493–6).

    Techniques Used: Expressing, Western Blot, RNA Sequencing Assay

    MYC regulates SREBP and together they regulate lipogenesis. (A) mRNA expression of fatty acid synthesis genes: Acly, Acaca, Fasn, and Scd1 upon siRNA knockdown of SREBP1 or scramble RNA in HCC(EC4) under MYC ON and OFF conditions (N=3 per condition). Statistical significance by two-way ANOVA using Tukey’s multiple comparisons post tests, ***P<0.001. Overall, ***P<0.001 for SREBP1 effect, ***P<0.001 for MYC effect and ***P<0.001 for interaction between the two. (B) SREBP1 ChIP-qPCR on BCL P493–6 line shows decreased binding of SREBP1 upon MYC inactivation (top panel). MYC ChIP-qPCR on HCC EC4 line shows no change of MYC binding upon SREBP1 knockdown (bottom panel). (C) Glucose and glutamine incorporation into lipids by NMR in MYC ON (upper panel) and OFF (bottom panel) in BCL(P493–6). For close-up look see Figure S3B. (D) Incorporation of glucose and glutamine carbons to de novo synthesized fatty acids by mass spectrometry based on the fold change of 2C13 peak in BCL(P493–6) as measured upon 24 hours of MYC inactivation (N=5). Fold change in the de novo fatty acid synthesis when MYC is activated or inactivated (left panel); and glucose and glutamine incorporation into fatty acids when MYC is activated (middle panel), or inactivated (right panel). Statistical significance by t-test, **P<0.01, ***P<0.001.
    Figure Legend Snippet: MYC regulates SREBP and together they regulate lipogenesis. (A) mRNA expression of fatty acid synthesis genes: Acly, Acaca, Fasn, and Scd1 upon siRNA knockdown of SREBP1 or scramble RNA in HCC(EC4) under MYC ON and OFF conditions (N=3 per condition). Statistical significance by two-way ANOVA using Tukey’s multiple comparisons post tests, ***P<0.001. Overall, ***P<0.001 for SREBP1 effect, ***P<0.001 for MYC effect and ***P<0.001 for interaction between the two. (B) SREBP1 ChIP-qPCR on BCL P493–6 line shows decreased binding of SREBP1 upon MYC inactivation (top panel). MYC ChIP-qPCR on HCC EC4 line shows no change of MYC binding upon SREBP1 knockdown (bottom panel). (C) Glucose and glutamine incorporation into lipids by NMR in MYC ON (upper panel) and OFF (bottom panel) in BCL(P493–6). For close-up look see Figure S3B. (D) Incorporation of glucose and glutamine carbons to de novo synthesized fatty acids by mass spectrometry based on the fold change of 2C13 peak in BCL(P493–6) as measured upon 24 hours of MYC inactivation (N=5). Fold change in the de novo fatty acid synthesis when MYC is activated or inactivated (left panel); and glucose and glutamine incorporation into fatty acids when MYC is activated (middle panel), or inactivated (right panel). Statistical significance by t-test, **P<0.01, ***P<0.001.

    Techniques Used: Expressing, Binding Assay, Synthesized, Mass Spectrometry

    KEY RESOURCES TABLE
    Figure Legend Snippet: KEY RESOURCES TABLE

    Techniques Used: Recombinant, Chromatin Immunoprecipitation, RNA Extraction, Transgenic Assay, Software

    Related Articles

    Recombinant:

    Article Title: The MYC Oncogene Cooperates with Sterol Regulated Element-Binding Protein To Regulate Lipogenesis Essential for Neoplastic Growth
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-SREBP1 (clone 2A4) [1:1000] home-made antibody N/A Rabbit monoclonal anti-MYC (Y69) [1:1000] Abcam CAS# ab32072 IgG from mouse serum [1:1000] Sigma CAS# I5006 IgG from rabbit serum [1:1000] Sigma CAS# I5381 MYC [1:1000] Abcam Ab32072 SREBP1 [1:1000] Novus Biologicals NB600–582 SCD1 [1:1000] Cell Signaling Tech CST 2794 FASN [1:500] Sigma-Aldrich F9554 ACLY [1:1000] Cell Signaling Tech CST 4332S ACACA [1:1000] Cell Signaling Tech CST 3661 Chemicals, Peptides, and Recombinant Proteins Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP) Sigma-Aldrich CAS# C2920 Rotenone Sigma-Aldrich CAS# R8875 Seahorse XFe96 FluxPak Agilent Technologies CAS# 102416–100 XF Base Medium Seahorse Bioscience CAS# 102353–100 D-Glucose-1- 13 C Sigma 297046 L-Glutamine- 13 C 5 Sigma 605166 Critical Commercial Assays ChIP-IT® Express Chromatin Immunoprecipitation Kits Active Motif 53008 Qiagen RNA Extraction kit (RNEasy Plus Kit) Qiagen 74134 Deposited Data MYC Targeted Long Noncoding RNA DANCR Promotes Cancer in Part by Reducing p21 Levels. .. {"type":"entrez-geo","attrs":{"text":"GSE120246","term_id":"120246"}} GSE120246 Experimental Models: Cell Lines Human: Glioblastoma U87 cells Cell Services (CRUK-LRI) N/A Human: Renal cancer 786–0 cells ATCC CRL1932 P493–6 Burkitt Lymphoma (RRID:CVCL_6783) Experimental Models: Organisms/Strains MYC transgenic mice also available from Jackson FVB/N-Tg(tetO-MYC)28aBop/J Jackson Lab 019376 Liver-specific mice also available as MGI:Tg(Cebpb-tTA)5Bjd or (LAP-tTA) crossed with MYC transgenic mice to generate MYC HCC MGI MGI:3056818 Kidney-specific mice also available at MGI: Tg(Ggt1-tTA)#Agoc or (GGT-tTA) crossed with MYC transgenic mice to generate MYC RCC MGI MGI:5705528 Lung-specific mice also available from Jackson: B6.Cg-Tg(Scgb1a1-rtTA)1Jaw/J or (CCSP-tTA) crossed with MYC transgenic mice to generate MYC LC Jackson Lab 006232 Oligonucleotides ACLY/Acly Harvard Primer Bank GGTCTCGTTGGGGTCAACC / GAAGGGCTCGATCAGAAAGTTC ACACA/Acaca Harvard Primer Bank ATGTCTGGCTTGCACCTAGTA / CCCCAAAGCGAGTAACAAATTCT FASN/Fasn Harvard Primer Bank AAGGACCTGTCTAGGTTTGATGC / TGGCTTCATAGGTGACTTCCA SCD1/Scd1 Harvard Primer Bank ACTGCCAGAGAACATCACACA / GGGGTAGGGTAAGCACAGTAG SREBP1/Srebp1 Harvard Primer Bank ACAGTGACTTCCCTGGCCTAT / GCATGGACGGGTACATCTTCAA HK2 Harvard Primer Bank GAGCCACCACTCACCCTACT / CCAGGCATTCGGCAATGTG LDHA Harvard Primer Bank ATGGCAACTCTAAAGGATCAGC / CCAACCCCAACAACTGTAATCT GLS Harvard Primer Bank AGGGTCTGTTACCTAGCTTGG / ACGTTCGCAATCCTGTAGATTT SCAP Harvard Primer Bank TATCTCGGGCCTTCTACAACC / GGGGCGAGTAATCCTTCACA CS Harvard Primer Bank TGCTTCCTCCACGAATTTGAAA / CCACCATACATCATGTCCACAG Software and Algorithms Seahorse Wave Controller Software Instrument software by Agilent https://www.agilent.com/en/products/cell-analysis/cell-analysis-software/instrument-software/wave-controller-2-4 Bio Map software Novartis http://www.ms-imaging.org Other AGPAT1 Harvard Primer Bank AGGACGCAACGTCGAGAAC / GCAGTACCTCCATCATCCCAAG PGS1 Harvard Primer Bank CTCCAGTTCTCACGTTAGGGT / CCTCTTGGCTACTCTTATCTGCC PTPMT1 Harvard Primer Bank CAGAGGAGGCTGTAAGAGCCA / TGTGGATGTATGACCGGATCT Open in a separate window KEY RESOURCES TABLE MYC induces SREBP1, thereby regulating fatty acid synthesis and lipogenesis Induction of MYC expression upregulates lipogenesis genes across MYC-cancers Mass spectrometry imaging shows common lipid changes across different MYC-cancers Inhibition of lipogenesis reverts MYC-tumors in both xenograft and mouse models Context and Significance Understanding the metabolic requirements of cancer cells can lead to the development of new and effective therapies.

    Chromatin Immunoprecipitation:

    Article Title: The MYC Oncogene Cooperates with Sterol Regulated Element-Binding Protein To Regulate Lipogenesis Essential for Neoplastic Growth
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-SREBP1 (clone 2A4) [1:1000] home-made antibody N/A Rabbit monoclonal anti-MYC (Y69) [1:1000] Abcam CAS# ab32072 IgG from mouse serum [1:1000] Sigma CAS# I5006 IgG from rabbit serum [1:1000] Sigma CAS# I5381 MYC [1:1000] Abcam Ab32072 SREBP1 [1:1000] Novus Biologicals NB600–582 SCD1 [1:1000] Cell Signaling Tech CST 2794 FASN [1:500] Sigma-Aldrich F9554 ACLY [1:1000] Cell Signaling Tech CST 4332S ACACA [1:1000] Cell Signaling Tech CST 3661 Chemicals, Peptides, and Recombinant Proteins Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP) Sigma-Aldrich CAS# C2920 Rotenone Sigma-Aldrich CAS# R8875 Seahorse XFe96 FluxPak Agilent Technologies CAS# 102416–100 XF Base Medium Seahorse Bioscience CAS# 102353–100 D-Glucose-1- 13 C Sigma 297046 L-Glutamine- 13 C 5 Sigma 605166 Critical Commercial Assays ChIP-IT® Express Chromatin Immunoprecipitation Kits Active Motif 53008 Qiagen RNA Extraction kit (RNEasy Plus Kit) Qiagen 74134 Deposited Data MYC Targeted Long Noncoding RNA DANCR Promotes Cancer in Part by Reducing p21 Levels. .. {"type":"entrez-geo","attrs":{"text":"GSE120246","term_id":"120246"}} GSE120246 Experimental Models: Cell Lines Human: Glioblastoma U87 cells Cell Services (CRUK-LRI) N/A Human: Renal cancer 786–0 cells ATCC CRL1932 P493–6 Burkitt Lymphoma (RRID:CVCL_6783) Experimental Models: Organisms/Strains MYC transgenic mice also available from Jackson FVB/N-Tg(tetO-MYC)28aBop/J Jackson Lab 019376 Liver-specific mice also available as MGI:Tg(Cebpb-tTA)5Bjd or (LAP-tTA) crossed with MYC transgenic mice to generate MYC HCC MGI MGI:3056818 Kidney-specific mice also available at MGI: Tg(Ggt1-tTA)#Agoc or (GGT-tTA) crossed with MYC transgenic mice to generate MYC RCC MGI MGI:5705528 Lung-specific mice also available from Jackson: B6.Cg-Tg(Scgb1a1-rtTA)1Jaw/J or (CCSP-tTA) crossed with MYC transgenic mice to generate MYC LC Jackson Lab 006232 Oligonucleotides ACLY/Acly Harvard Primer Bank GGTCTCGTTGGGGTCAACC / GAAGGGCTCGATCAGAAAGTTC ACACA/Acaca Harvard Primer Bank ATGTCTGGCTTGCACCTAGTA / CCCCAAAGCGAGTAACAAATTCT FASN/Fasn Harvard Primer Bank AAGGACCTGTCTAGGTTTGATGC / TGGCTTCATAGGTGACTTCCA SCD1/Scd1 Harvard Primer Bank ACTGCCAGAGAACATCACACA / GGGGTAGGGTAAGCACAGTAG SREBP1/Srebp1 Harvard Primer Bank ACAGTGACTTCCCTGGCCTAT / GCATGGACGGGTACATCTTCAA HK2 Harvard Primer Bank GAGCCACCACTCACCCTACT / CCAGGCATTCGGCAATGTG LDHA Harvard Primer Bank ATGGCAACTCTAAAGGATCAGC / CCAACCCCAACAACTGTAATCT GLS Harvard Primer Bank AGGGTCTGTTACCTAGCTTGG / ACGTTCGCAATCCTGTAGATTT SCAP Harvard Primer Bank TATCTCGGGCCTTCTACAACC / GGGGCGAGTAATCCTTCACA CS Harvard Primer Bank TGCTTCCTCCACGAATTTGAAA / CCACCATACATCATGTCCACAG Software and Algorithms Seahorse Wave Controller Software Instrument software by Agilent https://www.agilent.com/en/products/cell-analysis/cell-analysis-software/instrument-software/wave-controller-2-4 Bio Map software Novartis http://www.ms-imaging.org Other AGPAT1 Harvard Primer Bank AGGACGCAACGTCGAGAAC / GCAGTACCTCCATCATCCCAAG PGS1 Harvard Primer Bank CTCCAGTTCTCACGTTAGGGT / CCTCTTGGCTACTCTTATCTGCC PTPMT1 Harvard Primer Bank CAGAGGAGGCTGTAAGAGCCA / TGTGGATGTATGACCGGATCT Open in a separate window KEY RESOURCES TABLE MYC induces SREBP1, thereby regulating fatty acid synthesis and lipogenesis Induction of MYC expression upregulates lipogenesis genes across MYC-cancers Mass spectrometry imaging shows common lipid changes across different MYC-cancers Inhibition of lipogenesis reverts MYC-tumors in both xenograft and mouse models Context and Significance Understanding the metabolic requirements of cancer cells can lead to the development of new and effective therapies.

    RNA Extraction:

    Article Title: The MYC Oncogene Cooperates with Sterol Regulated Element-Binding Protein To Regulate Lipogenesis Essential for Neoplastic Growth
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-SREBP1 (clone 2A4) [1:1000] home-made antibody N/A Rabbit monoclonal anti-MYC (Y69) [1:1000] Abcam CAS# ab32072 IgG from mouse serum [1:1000] Sigma CAS# I5006 IgG from rabbit serum [1:1000] Sigma CAS# I5381 MYC [1:1000] Abcam Ab32072 SREBP1 [1:1000] Novus Biologicals NB600–582 SCD1 [1:1000] Cell Signaling Tech CST 2794 FASN [1:500] Sigma-Aldrich F9554 ACLY [1:1000] Cell Signaling Tech CST 4332S ACACA [1:1000] Cell Signaling Tech CST 3661 Chemicals, Peptides, and Recombinant Proteins Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP) Sigma-Aldrich CAS# C2920 Rotenone Sigma-Aldrich CAS# R8875 Seahorse XFe96 FluxPak Agilent Technologies CAS# 102416–100 XF Base Medium Seahorse Bioscience CAS# 102353–100 D-Glucose-1- 13 C Sigma 297046 L-Glutamine- 13 C 5 Sigma 605166 Critical Commercial Assays ChIP-IT® Express Chromatin Immunoprecipitation Kits Active Motif 53008 Qiagen RNA Extraction kit (RNEasy Plus Kit) Qiagen 74134 Deposited Data MYC Targeted Long Noncoding RNA DANCR Promotes Cancer in Part by Reducing p21 Levels. .. {"type":"entrez-geo","attrs":{"text":"GSE120246","term_id":"120246"}} GSE120246 Experimental Models: Cell Lines Human: Glioblastoma U87 cells Cell Services (CRUK-LRI) N/A Human: Renal cancer 786–0 cells ATCC CRL1932 P493–6 Burkitt Lymphoma (RRID:CVCL_6783) Experimental Models: Organisms/Strains MYC transgenic mice also available from Jackson FVB/N-Tg(tetO-MYC)28aBop/J Jackson Lab 019376 Liver-specific mice also available as MGI:Tg(Cebpb-tTA)5Bjd or (LAP-tTA) crossed with MYC transgenic mice to generate MYC HCC MGI MGI:3056818 Kidney-specific mice also available at MGI: Tg(Ggt1-tTA)#Agoc or (GGT-tTA) crossed with MYC transgenic mice to generate MYC RCC MGI MGI:5705528 Lung-specific mice also available from Jackson: B6.Cg-Tg(Scgb1a1-rtTA)1Jaw/J or (CCSP-tTA) crossed with MYC transgenic mice to generate MYC LC Jackson Lab 006232 Oligonucleotides ACLY/Acly Harvard Primer Bank GGTCTCGTTGGGGTCAACC / GAAGGGCTCGATCAGAAAGTTC ACACA/Acaca Harvard Primer Bank ATGTCTGGCTTGCACCTAGTA / CCCCAAAGCGAGTAACAAATTCT FASN/Fasn Harvard Primer Bank AAGGACCTGTCTAGGTTTGATGC / TGGCTTCATAGGTGACTTCCA SCD1/Scd1 Harvard Primer Bank ACTGCCAGAGAACATCACACA / GGGGTAGGGTAAGCACAGTAG SREBP1/Srebp1 Harvard Primer Bank ACAGTGACTTCCCTGGCCTAT / GCATGGACGGGTACATCTTCAA HK2 Harvard Primer Bank GAGCCACCACTCACCCTACT / CCAGGCATTCGGCAATGTG LDHA Harvard Primer Bank ATGGCAACTCTAAAGGATCAGC / CCAACCCCAACAACTGTAATCT GLS Harvard Primer Bank AGGGTCTGTTACCTAGCTTGG / ACGTTCGCAATCCTGTAGATTT SCAP Harvard Primer Bank TATCTCGGGCCTTCTACAACC / GGGGCGAGTAATCCTTCACA CS Harvard Primer Bank TGCTTCCTCCACGAATTTGAAA / CCACCATACATCATGTCCACAG Software and Algorithms Seahorse Wave Controller Software Instrument software by Agilent https://www.agilent.com/en/products/cell-analysis/cell-analysis-software/instrument-software/wave-controller-2-4 Bio Map software Novartis http://www.ms-imaging.org Other AGPAT1 Harvard Primer Bank AGGACGCAACGTCGAGAAC / GCAGTACCTCCATCATCCCAAG PGS1 Harvard Primer Bank CTCCAGTTCTCACGTTAGGGT / CCTCTTGGCTACTCTTATCTGCC PTPMT1 Harvard Primer Bank CAGAGGAGGCTGTAAGAGCCA / TGTGGATGTATGACCGGATCT Open in a separate window KEY RESOURCES TABLE MYC induces SREBP1, thereby regulating fatty acid synthesis and lipogenesis Induction of MYC expression upregulates lipogenesis genes across MYC-cancers Mass spectrometry imaging shows common lipid changes across different MYC-cancers Inhibition of lipogenesis reverts MYC-tumors in both xenograft and mouse models Context and Significance Understanding the metabolic requirements of cancer cells can lead to the development of new and effective therapies.



    Similar Products

    data myc targeted long noncoding rna dancr promotes cancer  (Qiagen)
    99
    Qiagen data myc targeted long noncoding rna dancr promotes cancer
    Upregulation of lipid metabolic genes by <t>MYC.</t> (A) Diagram of MYC’s regulation of the fatty acid synthesis pathway. (B) qPCR shows fatty acid synthesis mRNA expression in high MYC (MYC ON, N=3 per cell line) compared to 24 hours of MYC inactivation (MYC OFF, N=3 per cell line) in BCL (P493–6) and RCC (E28). Expression of lipogenesis proteins for BCL (P493–6) and RCC (E28) cells with MYC ON vs. MYC OFF, by Western blot analysis. Statistical significance by t-test, ***P<0.001. (C) <t>RNA-seq</t> analysis of lipid metabolic pathways in fold-change of RPKM comparing MYC ON/MYC OFF in BCL (P493–6).
    Data Myc Targeted Long Noncoding Rna Dancr Promotes Cancer, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/data+myc+targeted+long+noncoding+rna+dancr+promotes+cancer/RNeasy+Plus+Mini+Kit/pmc06911354-763-136-133
    Average 99 stars, based on 1 article reviews
    data myc targeted long noncoding rna dancr promotes cancer - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Upregulation of lipid metabolic genes by MYC. (A) Diagram of MYC’s regulation of the fatty acid synthesis pathway. (B) qPCR shows fatty acid synthesis mRNA expression in high MYC (MYC ON, N=3 per cell line) compared to 24 hours of MYC inactivation (MYC OFF, N=3 per cell line) in BCL (P493–6) and RCC (E28). Expression of lipogenesis proteins for BCL (P493–6) and RCC (E28) cells with MYC ON vs. MYC OFF, by Western blot analysis. Statistical significance by t-test, ***P<0.001. (C) RNA-seq analysis of lipid metabolic pathways in fold-change of RPKM comparing MYC ON/MYC OFF in BCL (P493–6).

    Journal: Cell metabolism

    Article Title: The MYC Oncogene Cooperates with Sterol Regulated Element-Binding Protein To Regulate Lipogenesis Essential for Neoplastic Growth

    doi: 10.1016/j.cmet.2019.07.012

    Figure Lengend Snippet: Upregulation of lipid metabolic genes by MYC. (A) Diagram of MYC’s regulation of the fatty acid synthesis pathway. (B) qPCR shows fatty acid synthesis mRNA expression in high MYC (MYC ON, N=3 per cell line) compared to 24 hours of MYC inactivation (MYC OFF, N=3 per cell line) in BCL (P493–6) and RCC (E28). Expression of lipogenesis proteins for BCL (P493–6) and RCC (E28) cells with MYC ON vs. MYC OFF, by Western blot analysis. Statistical significance by t-test, ***P<0.001. (C) RNA-seq analysis of lipid metabolic pathways in fold-change of RPKM comparing MYC ON/MYC OFF in BCL (P493–6).

    Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-SREBP1 (clone 2A4) [1:1000] home-made antibody N/A Rabbit monoclonal anti-MYC (Y69) [1:1000] Abcam CAS# ab32072 IgG from mouse serum [1:1000] Sigma CAS# I5006 IgG from rabbit serum [1:1000] Sigma CAS# I5381 MYC [1:1000] Abcam Ab32072 SREBP1 [1:1000] Novus Biologicals NB600–582 SCD1 [1:1000] Cell Signaling Tech CST 2794 FASN [1:500] Sigma-Aldrich F9554 ACLY [1:1000] Cell Signaling Tech CST 4332S ACACA [1:1000] Cell Signaling Tech CST 3661 Chemicals, Peptides, and Recombinant Proteins Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP) Sigma-Aldrich CAS# C2920 Rotenone Sigma-Aldrich CAS# R8875 Seahorse XFe96 FluxPak Agilent Technologies CAS# 102416–100 XF Base Medium Seahorse Bioscience CAS# 102353–100 D-Glucose-1- 13 C Sigma 297046 L-Glutamine- 13 C 5 Sigma 605166 Critical Commercial Assays ChIP-IT® Express Chromatin Immunoprecipitation Kits Active Motif 53008 Qiagen RNA Extraction kit (RNEasy Plus Kit) Qiagen 74134 Deposited Data MYC Targeted Long Noncoding RNA DANCR Promotes Cancer in Part by Reducing p21 Levels.

    Techniques: Expressing, Western Blot, RNA Sequencing Assay

    MYC regulates SREBP and together they regulate lipogenesis. (A) mRNA expression of fatty acid synthesis genes: Acly, Acaca, Fasn, and Scd1 upon siRNA knockdown of SREBP1 or scramble RNA in HCC(EC4) under MYC ON and OFF conditions (N=3 per condition). Statistical significance by two-way ANOVA using Tukey’s multiple comparisons post tests, ***P<0.001. Overall, ***P<0.001 for SREBP1 effect, ***P<0.001 for MYC effect and ***P<0.001 for interaction between the two. (B) SREBP1 ChIP-qPCR on BCL P493–6 line shows decreased binding of SREBP1 upon MYC inactivation (top panel). MYC ChIP-qPCR on HCC EC4 line shows no change of MYC binding upon SREBP1 knockdown (bottom panel). (C) Glucose and glutamine incorporation into lipids by NMR in MYC ON (upper panel) and OFF (bottom panel) in BCL(P493–6). For close-up look see Figure S3B. (D) Incorporation of glucose and glutamine carbons to de novo synthesized fatty acids by mass spectrometry based on the fold change of 2C13 peak in BCL(P493–6) as measured upon 24 hours of MYC inactivation (N=5). Fold change in the de novo fatty acid synthesis when MYC is activated or inactivated (left panel); and glucose and glutamine incorporation into fatty acids when MYC is activated (middle panel), or inactivated (right panel). Statistical significance by t-test, **P<0.01, ***P<0.001.

    Journal: Cell metabolism

    Article Title: The MYC Oncogene Cooperates with Sterol Regulated Element-Binding Protein To Regulate Lipogenesis Essential for Neoplastic Growth

    doi: 10.1016/j.cmet.2019.07.012

    Figure Lengend Snippet: MYC regulates SREBP and together they regulate lipogenesis. (A) mRNA expression of fatty acid synthesis genes: Acly, Acaca, Fasn, and Scd1 upon siRNA knockdown of SREBP1 or scramble RNA in HCC(EC4) under MYC ON and OFF conditions (N=3 per condition). Statistical significance by two-way ANOVA using Tukey’s multiple comparisons post tests, ***P<0.001. Overall, ***P<0.001 for SREBP1 effect, ***P<0.001 for MYC effect and ***P<0.001 for interaction between the two. (B) SREBP1 ChIP-qPCR on BCL P493–6 line shows decreased binding of SREBP1 upon MYC inactivation (top panel). MYC ChIP-qPCR on HCC EC4 line shows no change of MYC binding upon SREBP1 knockdown (bottom panel). (C) Glucose and glutamine incorporation into lipids by NMR in MYC ON (upper panel) and OFF (bottom panel) in BCL(P493–6). For close-up look see Figure S3B. (D) Incorporation of glucose and glutamine carbons to de novo synthesized fatty acids by mass spectrometry based on the fold change of 2C13 peak in BCL(P493–6) as measured upon 24 hours of MYC inactivation (N=5). Fold change in the de novo fatty acid synthesis when MYC is activated or inactivated (left panel); and glucose and glutamine incorporation into fatty acids when MYC is activated (middle panel), or inactivated (right panel). Statistical significance by t-test, **P<0.01, ***P<0.001.

    Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-SREBP1 (clone 2A4) [1:1000] home-made antibody N/A Rabbit monoclonal anti-MYC (Y69) [1:1000] Abcam CAS# ab32072 IgG from mouse serum [1:1000] Sigma CAS# I5006 IgG from rabbit serum [1:1000] Sigma CAS# I5381 MYC [1:1000] Abcam Ab32072 SREBP1 [1:1000] Novus Biologicals NB600–582 SCD1 [1:1000] Cell Signaling Tech CST 2794 FASN [1:500] Sigma-Aldrich F9554 ACLY [1:1000] Cell Signaling Tech CST 4332S ACACA [1:1000] Cell Signaling Tech CST 3661 Chemicals, Peptides, and Recombinant Proteins Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP) Sigma-Aldrich CAS# C2920 Rotenone Sigma-Aldrich CAS# R8875 Seahorse XFe96 FluxPak Agilent Technologies CAS# 102416–100 XF Base Medium Seahorse Bioscience CAS# 102353–100 D-Glucose-1- 13 C Sigma 297046 L-Glutamine- 13 C 5 Sigma 605166 Critical Commercial Assays ChIP-IT® Express Chromatin Immunoprecipitation Kits Active Motif 53008 Qiagen RNA Extraction kit (RNEasy Plus Kit) Qiagen 74134 Deposited Data MYC Targeted Long Noncoding RNA DANCR Promotes Cancer in Part by Reducing p21 Levels.

    Techniques: Expressing, Binding Assay, Synthesized, Mass Spectrometry

    KEY RESOURCES TABLE

    Journal: Cell metabolism

    Article Title: The MYC Oncogene Cooperates with Sterol Regulated Element-Binding Protein To Regulate Lipogenesis Essential for Neoplastic Growth

    doi: 10.1016/j.cmet.2019.07.012

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-SREBP1 (clone 2A4) [1:1000] home-made antibody N/A Rabbit monoclonal anti-MYC (Y69) [1:1000] Abcam CAS# ab32072 IgG from mouse serum [1:1000] Sigma CAS# I5006 IgG from rabbit serum [1:1000] Sigma CAS# I5381 MYC [1:1000] Abcam Ab32072 SREBP1 [1:1000] Novus Biologicals NB600–582 SCD1 [1:1000] Cell Signaling Tech CST 2794 FASN [1:500] Sigma-Aldrich F9554 ACLY [1:1000] Cell Signaling Tech CST 4332S ACACA [1:1000] Cell Signaling Tech CST 3661 Chemicals, Peptides, and Recombinant Proteins Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP) Sigma-Aldrich CAS# C2920 Rotenone Sigma-Aldrich CAS# R8875 Seahorse XFe96 FluxPak Agilent Technologies CAS# 102416–100 XF Base Medium Seahorse Bioscience CAS# 102353–100 D-Glucose-1- 13 C Sigma 297046 L-Glutamine- 13 C 5 Sigma 605166 Critical Commercial Assays ChIP-IT® Express Chromatin Immunoprecipitation Kits Active Motif 53008 Qiagen RNA Extraction kit (RNEasy Plus Kit) Qiagen 74134 Deposited Data MYC Targeted Long Noncoding RNA DANCR Promotes Cancer in Part by Reducing p21 Levels.

    Techniques: Recombinant, Chromatin Immunoprecipitation, RNA Extraction, Transgenic Assay, Software